Detailed information on CNT30416238


BLAST search results

BLAST vs Swiss-Prot:
sp|A4GYN8|RR12B_POPTR, E-value = 4e-57

BLAST vs NONCODE:
NONVVIT000515, E-value = 7e-167

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30677912Papaver somniferumSetaria viridis97.9146.6493.6750forward
CNT3021516Papaver somniferumCitrullus lanatus90.3437.6395.38692forward
CNT30730496Papaver somniferumCorchorus capsularis29.7720.9891.67228reverse complement
CNT30406883Papaver somniferumBeta vulgaris17.6252.5389.63135forward
CNT30524944Papaver somniferumPhaseolus vulgaris57.4444.1895440forward
CNT30201818Papaver somniferumPisum sativum44.2624.6293.81339forward
CNT30492881Papaver somniferumOlea europaea20.2324.0394.19155forward
CNT30710142Papaver somniferumGlycine max22.8539.2494.86175forward
CNT30300194Papaver somniferumTriticum aestivum64.123.3495.93491forward
CNT30220990Papaver somniferumHordeum vulgare30.4218.3989.27233forward
CNT30384007Papaver somniferumTriticum turgidum53.5246.9691.22410forward
CNT30569656Papaver somniferumActinidia chinensis43.8639.997.62336forward
CNT3083498Papaver somniferumVigna radiata24.1579.7487.03185reverse complement
CNT30543269Papaver somniferumBrassica napus65.0116.8291.97498forward
CNT30237740Papaver somniferumBrassica oleracea28.4618.1884.4218forward
CNT30509374Papaver somniferumSolanum lycopersicum9.663791.8974forward
CNT3077654Papaver somniferumBrassica juncea16.7128.4491.41128forward
CNT3018194Papaver somniferumZea mays71.0292.8392.65544forward
CNT30610163Papaver somniferumGossypium raimondii38.6455.6486.15296forward
CNT30228329Papaver somniferumAnanas comosus27.0210093.72207forward
CNT30684722Papaver somniferumTriticum urartu48.334.6891.89370forward
CNT30351849Papaver somniferumEragrostis tef18.836.1891.67144reverse complement
CNT30364733Papaver somniferumSorghum bicolor18.6758.6183.92143forward
CNT30355468Papaver somniferumLactuca sativa75.247.196.7576forward
CNT30324879Papaver somniferumAsparagus officinalis32.5170.9489.16249reverse complement
CNT30331679Papaver somniferumDioscorea rotundata23.3726.1397.21179forward
CNT30100515Papaver somniferumOryza rufipogon33.0399.6189.72253reverse complement
CNT30578120Papaver somniferumOryza barthii34.3345.6696.2263forward
CNT30604848Papaver somniferumOryza punctata30.0370.3485.65230reverse complement
CNT30725513Papaver somniferumLupinus angustifolius11.141.4694.1285reverse complement

Expression of CNT30416238

Peptides detected in this lncRNA

>peptide 1 (33 aa)
MRFSPHTAPRSTLSKSLDPCSRISSLLPLRPEE*

Sequence

>CNT30416238
CCTGTTCTAAAAAAGTCGAGGTATTTCGAATTGTTTGTTGACACGGACAAAGTCAGGGAAAACCTCTGAAATGATTTCAATATTGAACCTTGGACATATA
ATAGTTCCGAATCAAATCCCTTTAGAAAGAAGATCTTTTGTCTCATGGTAGCCTGCTCCAGTCCCCTTACGAAACTTTCGTTATTGGGTTAGCCATACAC
TTCACATGTTTCTAGCGATTCACATGGCATCATCAAATGATACAAGTCTTGGATAAGAATCTACAACGCACTAGAACGCCCTTGTTGACGATCTTTTACT
CCGACAGCATCTAGGGTTCCTCGAACAATGTGATATCTCACACCGGGTAAATCTTTAACCCTTCCTCCTCTTACTAAGACTACAGAATGTTCTTGTGAAT
TATGGCCAATACCAGGTATATAAGCAGTGATTTCAAATCCAGAGGTTAATCGTACTCTGGCAACTTTACGTAAGGCAGAGTTTGGTTTTTTGGGGGTGAT
AGTGGAAAAGTTGACAGATAAGTCACCCTTACTGTCACTCTACAGAACCGTACATGAGATTTTCACCTCATACGGCTCCTCGTTCAACTCTTTCGAAGTC
ATTGGATCCCTGTTCGAGAATCTCCTCCCTTCTTCCACTCCGTCCCGAAGAGTAACTAGGACCAATTCAGTCACGTTTTCATGTTCCAATTGAACACTTT
CCTTTTTTGATTATTATCAAAGGAGAAGATTCTTCTTTTTACCAAACATATGCGGATCCAATCACG