Detailed information on CNT30372643


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30382001Arabidopsis thalianaManihot esculenta34.5111.5483.13166forward
CNT30543692Arabidopsis thalianaBrassica napus43.0474.7390.34207forward
CNT30144056Arabidopsis thalianaMedicago truncatula17.8823.3184.8886forward
CNT3079681Arabidopsis thalianaBrassica juncea20.5818.8292.9399forward
CNT30261195Arabidopsis thalianaBrassica rapa10.623.8396.0851reverse complement
CNT30679799Arabidopsis thalianaTriticum urartu16.6325.8988.7580forward
CNT30348124Arabidopsis thalianaEragrostis tef29.7332.4382.52143forward

Expression of CNT30372643

Sequence

>CNT30372643
AATGAAAATGATAGTTATAAACGAGATAAAAAGATCTGTTTCATAAAATATCTGGAGATTCTACAGAAATTGTAGCTAAGACACATGAAGAGAAACTCAA
ATACGGAAGCAACAACTGCAAAACACTGGGAAGATAGAACTAATAGCCTCCCTTGAGATCGTTGACGACATCGTACGGGATTGGAGTGACAGTCTCCAAG
GTCATTCCTTCGACCATGAATCCTGGTTTGGGTCCTTTAGTGACGTTCCAGATACGACCAGTACGACCGTGGTAGAACTTGTGAGGCATACCCTTGTGGA
TCGCACCATTCACCTTCACATCGACGTAATCGCCGACCTTGAAGGTTCTCAGGTAAGTCGAGAGTGGAATGTAACCCTTCTTCCTGAATGGCCTCGCGAA
CAGATCCCTCGTTCTCGCCCGAACTCCATGACCCGCTGGCATTTTTCCTCCTCGTGCGACAACTAAAACCCTAGATCGCCG