Detailed information on CNT30228831


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30639730Ananas comosusNymphaea colorata67.5223.0785.85212forward
CNT30518094Ananas comosusJuglans regia68.1522.8689.25214forward
CNT3020462Ananas comosusCitrullus lanatus98.0927.585.39308forward
CNT30629525Ananas comosusVigna unguiculata59.8743.7289.89188forward
CNT30160100Ananas comosusPistacia vera67.5222.3986.79212forward
CNT30224132Ananas comosusHordeum vulgare33.1215.1693.27104forward
CNT30588666Ananas comosusMusa acuminata48.0931.0784.77151forward
CNT30439068Ananas comosusAegilops tauschii57.9633.1590.11182forward
CNT30313731Ananas comosusCamelina sativa60.8365.1984.82191forward
CNT3015866Ananas comosusZea mays67.5229.5390.57212forward
CNT30608730Ananas comosusGossypium raimondii60.8331.8386.39191forward
CNT30651330Ananas comosusRosa chinensis60.8343.3187.96191forward
CNT30203420Ananas comosusHelianthus annuus60.8338.0583.25191forward
CNT30684845Ananas comosusTriticum urartu68.1513.0689.25214forward
CNT30368495Ananas comosusSorghum bicolor68.152189.72214forward
CNT3024315Ananas comosusPopulus trichocarpa63.6926.2187.5200forward
CNT30148140Ananas comosusBrachypodium distachyon39.8132.8992125forward
CNT30176038Ananas comosusVigna angularis60.8347.9984.29191forward

Expression of CNT30228831

Peptides detected in this lncRNA

>peptide 1 (65 aa)
GVVHDDDLRGKVGSLLGRVILGVGGNKATLQVLHGNVLHVEANIVTGEGLLEGLVVHLDRLNFSR*

Sequence

>CNT30228831
CCGGGGTGGTTCATGATGATGACCTGAGAGGTAAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGAGGCAACAAAGCCACGCTTCAAGTCCT
TCACGGCAACGTTCTTCACGTTGAAGCCAACATTGTCACCGGGGAGGGCCTCCTGGAGGGCCTCGTGGTGCATCTCGACCGACTTAACTTCAGTCGTTAG
GCCAGTAGGTCCAAAGGGAATCTTATCGGGGTTGTACCCAACCTTCTTAAGGTAGGAGGAGACTTCCTTAACAATTTCATCATATCTCGCCTTCGAGTAC
TTGGGGGTGGTGGC