Detailed information on CNT30228703


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30357894Ananas comosusLactuca sativa41.6112.8184.87119forward
CNT30117074Ananas comosusOryza nivara41.267.3188.14118forward

Expression of CNT30228703

Peptides detected in this lncRNA

>peptide 1 (39 aa)
HRRAPFRVLRVVDRVRAVAVGIPRGSGGRRRAPRGGPCR*

>peptide 2 (50 aa)
MPMNSPGPRVRPMSTATFEGEIIFIFVTRRSIRSSGSPNSRRAPRGGPCR*

Sequence

>CNT30228703
CCCACCGCCGCGCCCCCTTTCGCGTACTCCGTGTAGTGGATCGTGTACGCGCCGTCGCCGTTGGGATCCCGCGGGGCAGCGGAGGTAGGCGTCGAGCACC
TCGCGGCGGACCATGCCGATGAACTCGCCCGGGCCGAGGGTGCGCCCGATGTCGACGGCCACGTTCGAGGGGGAGATCATCTTCATCTTCGTCACGCGCC
GGTCGATAAGGTCCAGCGGGAGCCCAAACTCGCGTCGAGCACCTCGCGGCGGACCATGCCGATGAACTCGCCCGGGCCGAGGGTGC