Detailed information on CNT30210822


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30210822

Sequence

>CNT30210822
TTACATTAAACATTCATCATTCATTATATTATAAAATACTAAAAAAGGTAACAATTTGAGGTAGCAAGAAGATCAACCTGAGAAAACAGGACCCTAAAGT
CCCATAAAAAACATGGACCATGGTTCATAAAAAAACAACCACAAAGTGTTGTTAAATGGCTCCAGACCAACAAATCTGTTGCCACTTACCATAGACCAAA
AACCAGGTGCACCCTCCTTCGCCCTCAAACCGCTACGGACCACATACAACTGAC