Detailed information on CNT30136970


BLAST search results

BLAST vs Swiss-Prot:
sp|P26667|RBS2_WHEAT, E-value = 3e-73

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30672909Lolium perenneSetaria viridis56.3450.9280.83360forward
CNT30521106Lolium perenneSetaria italica58.5351.5980.75374forward
CNT30180865Lolium perenneSecale cereale60.5654.7487.6387forward
CNT30288382Lolium perenneTriticum aestivum60.4135.7487.56386forward
CNT30221752Lolium perenneHordeum vulgare60.4157.788.6386forward
CNT30386515Lolium perenneTriticum turgidum60.4127.8987.82386forward
CNT30555612Lolium perenneOryza glaberrima57.935.4186.22370forward
CNT30436411Lolium perenneAegilops tauschii60.4158.5788.6386forward
CNT30252135Lolium perenneAvena sativa60.7244.692.53388forward
CNT30658347Lolium perenneTriticum dicoccoides60.4171.4887.82386forward
CNT30681645Lolium perenneTriticum urartu60.4126.3888.34386forward
CNT30721860Lolium perenneTriticum spelta58.2264.8186.83372forward
CNT30351770Lolium perenneEragrostis tef52.1134.1281.38333forward
CNT30597241Lolium perenneOryza meridionalis47.8935.1383.66306forward
CNT30371468Lolium perenneOryza glumipatula38.8121.5584.68248forward
CNT30149714Lolium perenneBrachypodium distachyon56.9654.1788.46364forward
CNT30104669Lolium perenneOryza rufipogon57.944.6385.68370forward
CNT30578612Lolium perenneOryza barthii47.8927.0685.29306forward
CNT30118025Lolium perenneOryza nivara47.126.0284.05301forward
CNT30556975Lolium perennePanicum hallii55.5644.4383.1355forward
CNT30551876Lolium perenneOryza brachyantha54.340.3585.59347forward

Expression of CNT30136970

Sequence

>CNT30136970
GTACGGGTATAACATTATAGATTGGAAAAAATTCACTAGAAAAGTGAGGATTAAATTAGCCCCAATACACTAGAACCAAACATGTTTTCATTAACACGCT
TCCATCAGGAAAATTAAGCTTGTCGACCCACGTTGATAGGTACATAAATATTTGGTACACAGTGTATATGGAAGCAGAAGTAAAACCCTGAAACCAGAGT
CGTCAACAAAAAAAAAAGTGAACTTGTATAGGCTGCTGTTATTCGCAGCTAGCAGTTTATGCCTTGCCGGACTCCTCGCAGCCTGGTGGCTTGTAGGCGA
TGAAGCTGACGCACTGCACTTGACGGATGTTGTCGAAGCCAATGATGCGGATATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCCTTTGCGAC
CTGTGCGGCGTCGGTGCAGCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTCGTAGTATCCGGGAGTGCTGCCGAACTCGCGGAAGACGAAG
CCGACCTTGCTGAACTCCAGGCAGGGAACCCACTTGGAGCGGATGAGGAAGTCGATCTGCTTCAGGAGGTCCTCCGTGGACAGCAGTGGCAGGTAGGAAA
GGGTCTCGAACTTCTTGATGCCCTCAATCGGCCACACCT