Detailed information on CNT30132227


BLAST search results

BLAST vs Swiss-Prot:
sp|P20144|WUN1_SOLTU, E-value = 7e-18

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30589033Lolium perenneMusa acuminata12.9523.5482.893forward
CNT30496416Lolium perenneDigitaria exilis24.939.6288.83179forward

Expression of CNT30132227

Peptides detected in this lncRNA

>peptide 1 (42 aa)
MHPSRTDRHARGRGRGPGGSCGRCRGGGSATRTWMRRRRRGA*

Sequence

>CNT30132227
TTTAAGCGAAAAGAGTGGTACCAAAGCATATGATTTGGTAGTAGGAGTAATAATGAACACTACTAGTCTGTAATGCAAACCAAATTCCTTTATTATTCGA
CCATAACAGCAACGGCATGCAGGTAGCAGCCGCGAAGGCGCAGCCTCCATGACGCCGCCGCGTCGCCATCATCACCGGCGACTCAGGCAGTAGTACCAGA
CACGCAAATTAACTAACGACGGCAATCCAGACAGGGGTAGAAATTAAGCAAACGTCAGCCCATGCATCCAAGCCGGACGGACCGGCACGCTAGAGGGCGA
GGACGAGGCCCGGGAGGGAGTTGCGGGCGCTGTCGGGGCGGCGGCTCTGCCACACGCACTTGGATGCGGCGGCGGCGGCGAGGCGCGTGACGGTGAGGTC
GGTGTTGAAGTACTCGCGCAGCTGGGTGATCACCCCATCGGCGCCGACCGTCCAGGCGTGCACCCAGTAGGCGGCCTTATTCCCCTCGCCGGCGGCGGAG
GCGGAGGCGCCCTCGGCGATGACGGTGGAGCCGAAGGCCTCGACGGTGCGCGGCGCGAAGCGGAAGGAGGAGGCGCCGCCCTCCAGCTGAGCCAGGTTAG
CCAGCTCCTCCCGGAGTTTCCTGCCGCTCTCCTGTCGGAGACGAAGAAGACGACGACGAGGACGCTGCTTGGCTACCTGGTCGTGATCGTCTCGGCGAAA
AATCAAGAAAGATCGATG