Detailed information on CNT30131862


BLAST search results

BLAST vs Swiss-Prot:
sp|Q9SW70|SRP_VITRI, E-value = 5e-34

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30131862

Sequence

>CNT30131862
AGCTAACAGTAGTAGTAGAACATCACCATCATCATCCATGATCACATTATCTACGAGACTAAACCAGCGATACCACTACACACCTTGATGTTCCCCAGGA
TTCTTTCAGTACGTAGCTTATTCAGTTGAGGCCACGAGCGATACAGTACAGACCTCGTTTATCAGGGCAGTGTAGGAGCACGGCGTTGCTACTAGATCAA
GATCCATAGGCTTGGCCTCCGGCGACCCTTCCCCGACGGTCTCGTTCACTTCCACAGGCTTGGCCTCCGGCGGCGACCCCTCCCCGAACACCTTGGCGAT
GCGCTCGACGGGGACGGCCGGGAGGTACCGGGCTCCGGGGAGCCCGTGCCCAGCCGCGTAGACGATCACCCTGTTGTACTTCTCGCACCAGTAGGCGGCG
GTGGGCACGGCGATCTGCGCCACCTGCGGGAAGAGCGGCAGCCCGTTGAGCGCGCGCCAGGTGGAGACGGCGAGGTGCTCCGCCGCCGGCTCGTAGCGCA
CGTACAGGTCCCTGGCCGCCGGCTCGATCCTCCCGTACGCGTCCTTGGCCACCGGCTCCACCTTCCCGTACACGGCGCGCGCCGCGCCGGTCACGCCCGA
CCGACGCGCCTCGTCGACGATCTCCCTCGCCAGCTCCGGCGCCGCCTGGGCCGCCTCGTACGCTTTCGCTGACGCCGACTTGAG