Detailed information on CNT3013020


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30674495Zea maysSetaria viridis51.8230.0898.25114forward
CNT30381273Zea maysManihot esculenta34.5521.2988.1676forward
CNT30510004Zea maysSolanum lycopersicum21.3615.4193.6247forward
CNT30355733Zea maysLactuca sativa32.7328.9290.2872forward
CNT30724478Zea maysLupinus angustifolius25.919.4591.2357forward

Expression of CNT3013020

Peptides detected in this lncRNA

>peptide 1 (61 aa)
HGLGRDADVGVHLLQHLEDVDLVGLHGLLRLLFPLLALAALLGLARREVGTREGERLRRIA*

Sequence

>CNT3013020
ACATGGCCTTGGACGAGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTAGGTCTCCACGGACTTCTTCGCCTTCTTTTT
CCCCTTCTTGCCCTCGCCGCCCTCCTTGGACTTGCCCGCCGGGAGGTCGGGACTCGCGAGGGTGAGAGGCTGCGGCGAATTGCCTAGGTTGGTTTGAGAA
CGGAAGATTTCCTTGGCTGT