Detailed information on CNT30117949


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30691852Oryza nivaraOryza sativa80.4773.1799.74379forward
CNT30308534Oryza nivaraTriticum aestivum36.9429.6982.76174forward
CNT30553214Oryza nivaraOryza glaberrima58.657.599.28276forward
CNT30444138Oryza nivaraAegilops tauschii36.9427.3682.76174forward
CNT30350693Oryza nivaraEragrostis tef33.1217.7787.18156forward
CNT30361510Oryza nivaraSorghum bicolor42.2529.788.44199forward
CNT30575837Oryza nivaraOryza barthii91.7294.1297.92432forward
CNT30499344Oryza nivaraDigitaria exilis31.4220.4787.84148reverse complement

Expression of CNT30117949

Sequence

>CNT30117949
TTGTACACAACATATTGCAATTTTGCTGAGCAGAAGAACCAAATATGTTCCATGTTTCATGATCAATAAATAAGGACACTTCAGTTTCACTTTAAATTAT
GTAAGAAAACATCAAGACCGTATTCATAATTTGTTTCTTTTCGAAATCACACACACATACTGAGTCAGACAGACGCAACACATATATAGGTGCTAATAGT
AGTATATATACCCCGCAAATCCACGCGATCATTTATCACAAATTCTTAAATTGGCCATCGGCGAGATAGCCCAATTCCCCACCCCTAGTTCTTACCGCCG
ACGTACTGTTCGGCGTCGTGGATGATGACGTATCCGGCCTTCTTGGGGCTCTCGGAGTCGGACAGCTCGTCGTCGTCGTCTTCGCCGTAGACCTCGTCGT
AGGAGGGAGCGCAGGTGGAGGCGAGGAGGGACCAGACGAGGTACATGGTCGCGGCGGACGCGGAGGACGGT