Detailed information on CNT30117190


BLAST search results

BLAST vs Swiss-Prot:
sp|Q6Z4N6|40G2_ORYSJ, E-value = 2e-27

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30220900Oryza nivaraHordeum vulgare36.1932.8584.21114forward
CNT30554346Oryza nivaraOryza glaberrima23.4935.9298.6574forward
CNT30102410Oryza nivaraOryza rufipogon62.8676.1597.98198forward

Expression of CNT30117190

Sequence

>CNT30117190
AGAGTAGTATATAATTAAGAGGAGAATACGTACCTGGTAGTCGTCCCTGGGGTTCTTGGGGGCGAGGCAGGCGGTGCCGTTGCGGACGGTGAGGCAGTAG
TTCTCGTTGGCGCGGCAGAAGATCTTGAAGATCTGGTTCGGGTCCGACGGCGCCGCCGGTGCCTGGTTGTGGTGGTGCCCGAACCCAAACATCTTCGACC
CTTAATTCGATCGGTGCAACTCGCGACTCGCGAGAGAAATGTTTTTGTGCTGCGACTGCGAGCGATGATGCGAGGAGGAGGAGCGAGAGGTGCCACGCTT
TATAGAAGGCCAAGG