Detailed information on CNT30115941


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30460329Oryza nivaraSaccharum spontaneum14.1520.2189.4776forward
CNT30142664Oryza nivaraLolium perenne17.3230.194.6293forward
CNT30100102Oryza nivaraOryza rufipogon32.7753.8299.43176forward

Expression of CNT30115941

Sequence

>CNT30115941
CAGGGGCACATCTCAACCCAAAGCAAAAGCTAATCTCCATCGCTGATCCTCAGGACCTTAGAATCTAAGAAAAGCTTAGCTAGCTACTCAAAATCAAAAC
TATCACAAGACGGCCCCCGAGTGAAGAGCAAGAGGGGGGAAAAGAGAAAGGGTTTCCCGCACCTTCCATCCGGCGGAGAAGCCGAGGCGGGCGGCGAGGG
CGGCGCTGGCGGCCCAGCAGAGGAAGCAGAGGAGCGCGGCGAGGGCGCCAGCGCGGCGGTCGAGGAGGAGGAGGAGGAGCGCGGTGAGGAAGATGGGCCA
GACGAAGAGCGTGTGGATGAAGACGTTGACGGCGTTGCTGTGGTACGCGCCGTAGAAGGCGAAGTGGTGCTCCAGGTCGAGGAGGCCGCCGCCGCCGCCG
CCGCCGCTAGGCTTCGTCATGGCTGCGTGTGTTCGGGGGGTTCCTTCCAGGTGAGGACGACAAGAGTTTCAATTTGGCCGGGGGTGGGAACTGGGAAGTG
CGAACTGCTGCAACTGCGGTGCAGACGATGCCTTTGG