Detailed information on CNT30115726


BLAST search results

BLAST vs Swiss-Prot:
sp|P31853|ATPF2_SPIOL, E-value = 1e-12

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30678262Oryza nivaraSetaria viridis31.5738.397.71131forward
CNT30522428Oryza nivaraSetaria italica54.2239.6895.56225forward
CNT30295400Oryza nivaraTriticum aestivum53.7330.0991.03223forward
CNT30223111Oryza nivaraHordeum vulgare53.7329.8591.93223forward
CNT30391395Oryza nivaraTriticum turgidum20.7214.4890.786forward
CNT30662367Oryza nivaraTriticum dicoccoides53.7329.0791.03223forward
CNT30447424Oryza nivaraSaccharum spontaneum53.7320.0993.27223forward
CNT30135603Oryza nivaraLolium perenne53.7323.9394.17223forward
CNT3016310Oryza nivaraZea mays25.337.3794.29105forward
CNT30683548Oryza nivaraTriticum urartu53.7321.2491.48223forward
CNT30361586Oryza nivaraSorghum bicolor22.8920.3497.8995forward
CNT30579295Oryza nivaraEchinochloa crusgalli25.5415.7595.28106reverse complement

Expression of CNT30115726

Sequence

>CNT30115726
ATCATTGATTTTATACTTATCACGAGAAGTTCACTGAAATTACATTCTTAGGACAAGCAGCGTATACACACGGATAAAACACGGAGAAAATCTTTACGAG
AGATGGTTGGTGTTTGGGAGGCAAGAACGGCCGGCGGCGGGGCGGCCATTACGCGGATGGGAGCACCTTCTTGACGATCTCGTCGCTGAGGGAGGCGATC
TGGGCGTCGAGCGCCTTGACGGCCTCCTCCTTCTGCGCCTCGAGGTTGGCGAGCGCCTCCACGAGCTCGGCCTCGACGCGGCGGCGCCCCTCGTCCAGCT
TCGCCTCCAGCTCCTGGGTGGTCTCCTTCTTCATCTTGTTGAGCGCCGCGGCGATCTCGGCGCGTGCCGCCTTCAGCACGGAGTGCGCGGCGCGGAGGAG
GTAAGCAGCAGCAGC