Detailed information on CNT3011240


BLAST search results

BLAST vs Swiss-Prot:
sp|P37834|PER1_ORYSJ, E-value = 3e-41

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30673839Zea maysSetaria viridis21.9914.7688.6853forward
CNT30178639Zea maysSecale cereale40.2522.187.6397forward
CNT30286373Zea maysTriticum aestivum79.6744.1482.81192forward
CNT30382961Zea maysTriticum turgidum79.6735.0482.81192forward
CNT30435520Zea maysAegilops tauschii75.144.6982.87181forward
CNT30241644Zea maysAvena sativa24.079.8894.8358forward
CNT30140767Zea maysLolium perenne20.7515.779050forward
CNT30596354Zea maysOryza meridionalis20.336.793.8849forward
CNT30576413Zea maysOryza barthii30.2911.4187.6773forward
CNT30116828Zea maysOryza nivara74.6929.9581.11180forward

Expression of CNT3011240

Peptides detected in this lncRNA

>peptide 1 (79 aa)
VVAQVEGAEAAGVHLHQGGVVVQAGALGAEARHVRAVQLRVGVAGVVQAREVVEAVREGEAVRRADGVAGRQHRQVPGVQ

>peptide 2 (50 aa)
GSSSGRRCGSCRGPSPPGWCCRPGWRTWRGGAPCTRGPAPGRCRGRRPGP*

Sequence

>CNT3011240
GGTAGTAGCTCAGGTCGAAGGTGCGGAAGCTGCCGGGGTCCATCTCCACCAGGGTGGTGTTGTCGTCCAGGCTGGCGCACTTGGCGCGGAGGCGCGCCAT
GTACGCGCGGTCCAGCTCCGGGTCGGTGTCGCGGGCGTCGTCCAGGCCCGTGAAGTTGTAGAGGCGGTCCGAGAAGGAGAAGCAGTGCGACGTGCCGATG
GTGTGGCCGGCCGACAGCACCGCCAGGTCCCTGGTGTCCAG