Detailed information on CNT30104741


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30697494Oryza rufipogonOryza sativa72.4265.3100239forward
CNT30555645Oryza rufipogonOryza glaberrima76.0648.7497.21251forward
CNT30450733Oryza rufipogonSaccharum spontaneum16.972091.0756forward
CNT30371486Oryza rufipogonOryza glumipatula76.0650.597.21251forward
CNT30106587Oryza rufipogonOryza longistaminata78.1866.4992.64258forward
CNT30604867Oryza rufipogonOryza punctata65.7656.8182.03217forward

Expression of CNT30104741

Peptides detected in this lncRNA

>peptide 1 (40 aa)
LTRAEHTKIHSFISFDQSKHETSFLLAIKNTDGQPHSNTN*

>peptide 2 (40 aa)
MRAPPLSSSSSRRSCRRRGCRSHRRSRRRRHGRHRSRRRSS

Sequence

>CNT30104741
TTTGACGAGAGCGGAGCACACTAAGATTCATTCATTCATTTCATTTGATCAAAGCAAACACGAGACGAGCTTTCTTCTTGCGATCAAAAACACAGATGGG
CAACCACACAGTAACACAAACTAGATAGTAGTTCCACACAAAACTAACGATGATAACGATCGGATGATGATGATGGTAGCTCGATTAGATAGATAGATAA
CTTGGCCATGAGGGCCCCACCGCTCAGTTCCTCCAGTTCCCGTCGGAGTTGCCGCCGCCGCGGCTGCCGTAGCCACCGCCGTAGCCGCCGCCGCCGCCAC
GGCCGCCACCGTAGCCGCCGACGAAGCAGC