Detailed information on CNT30104181


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT001456, E-value = 2e-150

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30104181

Sequence

>CNT30104181
GGCTCGCGGATTTTAACAGGTTAGGCTTAATCTACCCAATTGGAAATCTCTTGCAGTAGCTTTTACTAGAAATCCATTTCTTCCACAAAGCTCCTGTGAC
CTAACCATCTAGATAGAAGCCTCGCAGTTTGCAAAGAAATCAAGCTTCTGGCTTCAAGTTCACAAGTATGAAAAGACCTGAGAGGAAAGAGCTGCGTAGA
GAGCTCCGGATTCTTTAGCAACTAGGAGAGCGACAGAGCTTCTTTTTTGAAAAGGCTAAATCCCTTTCTTCAATCCCACCTGCGGAGGCCCCAGTCTTTT
TATTCCCCCTAGCATCTGTCACGGTCACAAAGGTCTTATTTTTCATTCGGGTCGGTCACTTTTCCGGGCCGGGATCGAGAAGTGGAAGTCATAAAAAAGA
GATGTTTCTCTTCGCACCTCAGATCAAGAGGAAAGGTAGCTTGTCAAGCTGGTCTCACTATTGGAAATTCTAGCTTT