Detailed information on CNT30103490


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30695846Oryza rufipogonOryza sativa52.2984.76100445forward
CNT30554851Oryza rufipogonOryza glaberrima10077.2999.76851forward
CNT30596860Oryza rufipogonOryza meridionalis98.8295.5799.52841forward
CNT30371067Oryza rufipogonOryza glumipatula75.6881.5299.84644forward
CNT30577705Oryza rufipogonOryza barthii97.1873.3899.76827forward
CNT30117503Oryza rufipogonOryza nivara55.1197.5199.57469forward
CNT30604579Oryza rufipogonOryza punctata61.34101.9591.19522forward

Expression of CNT30103490

Peptides detected in this lncRNA

>peptide 1 (29 aa)
HITAHTWPRQLFESVSNILQIIDHTIQQT*

>peptide 2 (42 aa)
MFISNVSVEARGLTGGMRSTGSAGFAGTFASIANKSLSELFS*

Sequence

>CNT30103490
GCACATTACAGCACACACATGGCCAAGGCAGTTATTTGAATCAGTCTCCAACATACTTCAAATCATAGACCACACCATACAGCAAACATAGTATAAACAT
TGTCATAGAGAGTACAGCTGATAGCAGCTTGTAATATTCTAGCATTACTTTGGTAGCATCCCTCTACAAAACATAGCAGACATCACCAGCTCTTCATCTT
GGCCATACACATTCAACCTGACAAGAAAACCATATCCCATTTTACAACATATGTAATCTGTACATGAAAATGTATCTACAAGAAATCAAAATAGTAGGTA
GTGTGGAGTGCCTTACATGGTTTGCTAGTGACAGACCACACTGACCAGAACATTTCGTCTCCTCAGTAGCATCATTTTGCAGAAGGTTGTCCATTGATTC
ATCTGAGCTGCTCTCAACATAAGGTAATGGCAAATACTTCATCTCGGGATCGAAGGTGGGCATGTTTTGTGCGAGATTAGGCATGCCATTTCCCTGGGGC
ACGGCGATACCATAGTTGTTCCTCATTCTCTTTGGCGCTCCACCTGTCAGGTAAGCAGGTTCACCATATGCTGGCATGGCAGCATTAGGAACGAAGACTG
AAGTGTAGTCTGGGGTCAGGGTGTCATCCTCCCAACCAAAGTCTGAAGAGCCAAATGAGTTGCTGCTCGTATCAGAGAGCATGTTCATCTCGAATGTCTC
AGTGGAAGCAAGAGGTTTGACTGGAGGCATGAGATCAACAGGCTCTGCCGGCTTTGCAGGCACCTTTGCAAGCATTGCAAACAAATCATTGTCTGAACTG
TTTAGCTGAAAGAAAGCATCATCGCCACAGGTCTTCAGAGGTGGAGCTAGT