Detailed information on CNT30102881


BLAST search results

BLAST vs Swiss-Prot:
sp|Q6Z965|OPR7_ORYSJ, E-value = 9e-43

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30117460Oryza rufipogonOryza nivara48.7383.0999.42172forward

Expression of CNT30102881

Peptides detected in this lncRNA

>peptide 1 (29 aa)
MKSRPYDTRLGLPVGGVPWLRDVEVGEPP*

Sequence

>CNT30102881
CAAAAATAAGCTAAATCACCTCACCGTTGCCCTTTATTTTCCTTACAATACACAATCGTATCCTTGATTTACTTATCCCGCAGTACATTTACATCCGCGA
CTTAGGCTGTCCGAGGAACGGATAGTCCGTGTAACCCACGACAGGATCGGGCGTGTAGAATGTCTTACGCACGTACTTGTTCAGCCCGGCGTTCAGCCTG
AACCGCTCGACCAGGTCCGGGTTTGATATGAAGAGCCGCCCGTACGACACCAGACTCGGTCTGCCCGTAGGCGGTGTACCGTGGCTGCGTGACGTGGAGG
TAGGCGAGCCGCCCTGACTGCTGCTGGAGAGCATTCAGCCGCTCAACAACGGC