Detailed information on CNT30102818


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30184695Oryza rufipogonSecale cereale25.0810.819080forward
CNT30467374Oryza rufipogonSaccharum spontaneum28.53691.2191forward
CNT30370783Oryza rufipogonOryza glumipatula66.4636.4994.34212forward

Expression of CNT30102818

Peptides detected in this lncRNA

>peptide 1 (34 aa)
PRSTSALARSMRGMAAAASDGAATGSGSGWWRKK*

>peptide 2 (77 aa)
TVDVGLGEVDERDGRGGLRRRGDGEWVGVVAEEVGDGGDAGVDEALDAGLGVVEGVEVTEAVGAGDGGHMRTRVVSS*

Sequence

>CNT30102818
CCACGGTCGACGTCGGCCTTGGCGAGGTCGATGAGAGGGATGGCCGCGGCGGCCTCCGACGGCGCGGCGACGGGGAGTGGGTCGGGGTGGTGGCGGAAGA
AGTAGGGGACGGTGGTGACGCCGGCGTCGACGAGGCCCTTGACGCCGGCCTTGGTGTCGTCGAAGGCGTGGAGGTCACGGAGGCGGTCGGTGCCGGAGAC
GGTGGCCATATGCGCACGCGCGTCGTGAGCTCCTGAGATGAGCAAACGCTAGGGCGCGCAGGAACGAGGCTTCGCTGGTGGTTAAGAGCAACTGACGCCG
GTTGAACACTTGTGTAGTT