Detailed information on CNT30102816


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30695540Oryza rufipogonOryza sativa72.3896.65100519forward
CNT3068006Oryza rufipogonLeersia perrieri13.5329.1393.8197forward
CNT30577318Oryza rufipogonOryza barthii4145.399.66294forward
CNT30117418Oryza rufipogonOryza nivara78.880.9599.82565forward

Expression of CNT30102816

Peptides detected in this lncRNA

>peptide 1 (29 aa)
MKSSSGVVGNPHTHLSRRRRRRASGLMGG*

Sequence

>CNT30102816
CAGGGATGACTTTTGAAGAGATTTTCAGAAACAATAATAAAAGCTGTAGAGAAATGGAGTAGAAAATAGCAGGACCATTGTATGAAAAAAAAAAGCCCAA
GCCTTGATAGGAGTTATACACATGAAAAACAACCCAAACTTGGTTGAGTTAGCCCCTCTCGAGAGTAAAACACGGCCACTAATCTCAAAAAGCTAAGATT
AACGTCATCATTTTCACCATATACCCCACGCGCAATTTACTAATTAATCGGAAACTGATGAAATCATCATCGGGTGTAGTTGGAAACCCCCACACCCACC
TGAGCCGCCGCCGCCGCCGCCGGGCGAGTGGGCTCATGGGAGGTTGAGGAACACGGCGGTCGGGTCCGGGTCGGCCAGACTCTTGGTGATGGACGGGTAG
TCGGAGAAGTCGAGGCCGAGGGTGACGGCGGCGGAGTCCGGCTGCAGGAGGTCCGTGAACGAGTCCTCCTCCACGGCCGGGACGACGAGCTCCGTGGTGA
TCTCGCTCGTGGTGTCAGGCGCCGGCGGTGTCGTCGTCGTTGTGGAAGTCGTCGTCTTCTTCTCCGACGTAGCTTCGGTCGTCGTCTTGGCGGCGGAGTC
AGCGGCGGCTTCGACGAGGACTTCTTGCGCGTGCCGCCGCCGACGGGGACGTTGCGGAGCGTGCCACCCTTGGTCCAGTAGCGGCGGCAACACTTGCAGA
AGTGCCGGGGCTGGGAG