Detailed information on CNT30101907


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT005374, E-value = 2e-111

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30596475Oryza rufipogonOryza meridionalis10035.8695.15227forward
CNT30117055Oryza rufipogonOryza nivara46.750.7296.23106forward

Expression of CNT30101907

Sequence

>CNT30101907
GTGCAAATTAAAACCTTGATAACTTTGCCTTCCGGTCATGGAATCGAGCTAGGTTTTTTTTAACGGCTGCAGAATCACAGGCCTCACCGAAGAGAGACTG
GATTTGGAGAGTTGGACCCCCAGAGATTTTTCTAGAAATTACTTACTATAGGCCACGAAGCAGCGGTTGTTTCGGCGAAACGTCGAATATCTAAGGGTCT
ACAACTGGTTTTCAACGAGGTGGTTAG