Detailed information on CNT30101293


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30524111Oryza rufipogonSetaria italica27.7226.7993.45168forward
CNT30289259Oryza rufipogonTriticum aestivum24.2635.5987.07147forward
CNT30436443Oryza rufipogonAegilops tauschii23.9329.986.21145forward
CNT30242579Oryza rufipogonAvena sativa3330.8688200forward
CNT30658052Oryza rufipogonTriticum dicoccoides27.2339.6686.67165forward
CNT30463052Oryza rufipogonSaccharum spontaneum31.6824.5892.19192forward
CNT30720294Oryza rufipogonTriticum spelta62.8746.3583.99381forward
CNT30345326Oryza rufipogonEragrostis tef67.8258.9784.43411forward

Expression of CNT30101293

Sequence

>CNT30101293
AACGGCAAAGTTCATTTCATGAGTTAGATGGAAGCGCCTCACTCAAGAGAACTATCTAAATAGGGAGACATAGCCGAGGCAGCCTTTGTACAGATCCTAA
ACACCAACCATTTCAACCAAGAGGGGACCTACATAGCTATCAACCAAACTCCCAACTCAAGCTGCAGGTGCCTTGCGGGTCTTCTTCGCGGCCGGCGACC
GGACGGTCTTGGGCTTGGCCTTCGCCTTCGCCGCCGGAGACTTCTTGGGCTTGGCGACCACCTTCTTCTCCGGCGCCTTGCGCTTGGTGCCAGCGGCGGG
GGCCTTCTTGGGTTTGGCAGCGGCGGCGTCCTTCTTGGGTTTGGCGGCGTCCTTCGCTGGCTTCGGCGCTGCTGCCTTGGGGGCGGGGGCGGCAGGCTTG
GCCTTGGGCGAGTCCTTGGCGGCGTCGGAGAGCTTGTAGGAGGCCTTAACCTTGACGAGCTTGCCCTTGGAAGCGAACCCGCGCAGCTGGATGGAGAGCA
TCTTCTTGTAGTTGGCCGGCAGCGACGCCCCGTGCTTCTCCTCCATGTACTTGGCGATGGCGTGCGCGCTCGAGCCGGTCCTCTCCTTAAGCACCGTGAT
CGCCTC