Detailed information on CNT30100481


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30691215Oryza rufipogonOryza sativa68.7681.67100361forward

Expression of CNT30100481

Peptides detected in this lncRNA

>peptide 1 (97 aa)
AFLELPSNTAQLWPGDRISSSSSSSSSSSSSSPAPASSPARFPAAQVIYCNGICGGDTWQHEDSARVRETWAAQQAACEPRQQQRCVRYLASHRTGD*

>peptide 2 (46 aa)
HFLSFPATQHNYGQEIGYLLLPLPLPLPPPPLLLLHPLPRASLLLR*

Sequence

>CNT30100481
CGCATTTCTTGAGCTTCCCAGCAACACAGCACAACTATGGCCAGGAGATAGGATATCTTCTTCTTCCTCTTCCTCTTCCTCTTCCTCCTCCTCCTCTCCT
GCTCCTGCATCCTCTCCCGCGCGCTTCCCTGCTGCTCAGGTGATTTATTGCAACGGAATATGTGGTGGGGATACGTGGCAGCATGAGGACTCTGCGCGCG
TGAGAGAGACGTGGGCGGCACAACAGGCAGCGTGTGAGCCCCGGCAGCAGCAGCGATGCGTCCGATATTTGGCTTCCCACCGGACGGGCGATTAGAAGCA
TTTTTTTGAGAGATCCAGAAAGATATACTTGCGAGTTGCGAGACAGTACATCAGATCGCTGTGCACAGCATGTCTTTTATCTCGTTGCTCCACGTATAAT
TAAATTACAGTGCCATTTGAAGCAATAGAATGCTGGCAGAATGGCCAGCTTGAGATTAGTAGATTCTGTAATTATTTTTTTGAGTAAATTACATCTTGGG
CCACTCTTTTTTACCAATGTTGCAA