Detailed information on CNT30100205


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT002675, E-value = 6e-173

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30691250Oryza rufipogonOryza sativa85.5172.8699.81537forward
CNT30107196Oryza rufipogonOryza longistaminata28.543.5598.32179forward
CNT30575186Oryza rufipogonOryza barthii53.562.3495.54336forward

Expression of CNT30100205

Peptides detected in this lncRNA

>peptide 1 (30 aa)
MRIRPTASDDPVICCPEVCCIQLLLLIDLA*

>peptide 2 (46 aa)
RPGPVKVQSARHPPSPRPAPPPPPPRHARRCSPTPVAESSPLSRPA*

Sequence

>CNT30100205
TAAGGCCGGGCCCAGTTAAGGTCCAATCTGCCAGGCACCCTCCCTCCCCGCGGCCGGCGCCGCCGCCGCCGCCGCCGCGCCATGCCCGCCGGTGCTCCCC
GACTCCGGTCGCCGAATCGAGCCCGCTCTCCCGCCCGGCCTGATCCCTCGCGCTCACCGTAGAATCATTTCCGCGCCAATGCGCGATCTTCTGTTCCTGC
CTGCCGCTCTAGGATAACCGTCTCCACTTCCATTTGGGAAACCCTAGAAGTTTATGCGGATACGGCCGACGGCCTCGGATGATCCAGTGATCTGCTGTCC
AGAGGTATGCTGTATTCAGTTATTGCTGTTGATTGATCTGGCTTAAGCTTGGGCTATAAGAAATCATCAGACCATGGCCGGAGATAGTGACAGCTATCAT
TGTGTCACAGGTCTTGGTTGGTTTGCGACCTAACTGAAGTAGAGCTAGAAAAACCTTGATAGGACAATCTGATCATATAACACCCCTACAGCAAAGAATG
CACCAAAGGAAATCATAAAGACAAATGATGATACAACCTTGTCAGCATTTTGTTTTGTGGAGACAAATGGTGTTTGTGCTAAACCACAATGGCGTGCAAG
CATAGGACCACACAACTTTGGGTTCCCA