Detailed information on CNT30693914


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30604173Oryza sativaOryza punctata43.0231.3693.51154forward

Expression of CNT30693914

Sequence

>CNT30693914
TTTTTAGCAACTTATAAAATTTAGGTTTTCTATTTTTTTTCAACATCATATTGTCGCTGAATAGTTAAATTGATAAGTATAGTCAATTCCTGACTGACTG
AGAATTGTGCCCAAAGAAACGCTACCGTTTTCGACTGTTTTCACCCCTATATACACTGTTGCAATCAGGAGAGCACAAATATAACTCTTTGCAGGCGACC
AATGGCCTCTCTACAACAGAAAATGCAGTTTGGCAGCACCCAGTCCTATACACTGTAGCCGTCCCAGGAAGAGCTGACGATTGTCAGGTTGTAAGGATGC
CAGGTACAGTCCCTGATGATCGATCCATGCCACGAAAGCTTCTCGACGATATCCCCAG