Detailed information on CNT30671969


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30641194Setaria viridisNymphaea colorata38.9112.582.46114forward
CNT30287025Setaria viridisTriticum aestivum27.6514.7392.5981forward
CNT30552809Setaria viridisOryza glaberrima51.8830.8990.13152forward
CNT30451383Setaria viridisSaccharum spontaneum75.4339.7595.02221forward
CNT30231280Setaria viridisAnanas comosus50.1719.0488.44147forward
CNT30650917Setaria viridisRosa chinensis52.924.2687.1155forward
CNT30110917Setaria viridisOryza longistaminata30.7217.9696.6790reverse complement
CNT30324863Setaria viridisAsparagus officinalis26.2834.2284.4277reverse complement
CNT30496106Setaria viridisDigitaria exilis95.2239.7496.06279forward

Expression of CNT30671969

Sequence

>CNT30671969
CCAGGCAGGAGCCACAGCAATTTAAAAGCTAGCAAGTCTTCTTAACACAAATAGCTGAGACAGGAAAGCACTACTAGTTCAGATATAGATCTCAAAACCA
AGAGGCAGACAAGGACTGAAACCTAGGCGGTGAGCACGACGGCTCCGCCGGCGGCCTTGATCTTCTTCTCGGCGACCTTGGAGATGAGCTTGGCCTTGAC
GACGATGGGCTTGGACGGCAGCTTCCCCTTGCCGAGCACCTTGAAGTAGCCGAACTGAGTGACGTCGATCTGCGGGGGAGGGAGTGGAGGAGG