Detailed information on CNT30604335


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Expression of CNT30604335

Sequence

>CNT30604335
TTATTTTTCAGTAATAAACGATATACCTGTTGATAACGAGATATTATTGTAATTTTATTAATCTCAATATATGTCGGGCAAAATATATGCTTTGTGCATG
TGTGCATTCATAATCACACTCACCTAGTCAAATACCAAGATCAATCGATCGATGTACAAGTGGATGCATTAATTCATCATCTTCAGTGTTCATATATTAC
AAATCACCACCATGCATTCAAGTCGCCATTAACCACCAACCAGCTCTCCTAATTTAAGCAGTAATCAACAAAAGGATGACCTCTCGCCATACTCTTCCTC
GCTCGTCATCACAAAACTAAACCGCGCGTACGTACGCGCGCGCGCGCGAACGCACACCAACGCACGCAAACGCGTCGATCCCATTTGAATTGCGCGCGAA
GTTTTTTAAGAGGAGGAGAAGGTGTCGAAGATGGTGGTGTGGAGCGGGTCGCTGAGGTGAGTAGCCCAGTTGTTGAGGGGGCCCTTGCCGGAACGTGCTC
GCCGCCGCTGCCACCGACGACGCCATGGCTGCTCTTCTCCTTCTCCTTCTCCTTCTCCTTCTTCTTCTTCGAGAATGTGTGGGTGGTGGTGAGGGGGCT