Detailed information on CNT30568533


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30618064Actinidia chinensisSesamum indicum26.2724.185.0767forward
CNT30728738Actinidia chinensisCorchorus capsularis43.1417.1385.45110forward
CNT30490297Actinidia chinensisOlea europaea25.885.9189.3966forward
CNT3086406Actinidia chinensisVigna radiata34.93.7884.2789forward
CNT30600323Actinidia chinensisFraxinus excelsior26.279.0588.0667forward
CNT30115465Actinidia chinensisOryza nivara21.185.2592.5954forward

Expression of CNT30568533

Peptides detected in this lncRNA

>peptide 1 (49 aa)
LRLHDGFLVAEVFGGATGFGFAGGSGLVLPVDVHQEEEEHDGLCSGGVA*

Sequence

>CNT30568533
CTGAGACTTCATGATGGATTTCTGGTGGCGGAGGTATTCGGAGGGGCTACAGGATTCGGATTCGCAGGAGGGTCGGGTCTCGTACTTCCAGTAGATGTCC
ATCAGGAGGAAGAGGAGCATGATGGCCTCTGCTCCGGCGGTGTAGCCTAGCACCACCCATTCCAACGCCATTTGTGATGAAGATGAGAAGGTTTGTTGCG
ATTTGTGTGTTACCGGTGTCTAGAGAGAGAGGGCCGAGAGATCTCGCTCTGAGAT