Detailed information on CNT30467443


BLAST search results

BLAST vs Swiss-Prot:
sp|P27789|FER5_MAIZE, E-value = 9e-37

BLAST vs NONCODE: nothing found

Expression of CNT30467443

Sequence

>CNT30467443
CTCGATCCACGGATGAAAACTCAACGCGTACATGAATAATATAATTGCAATTGCAAAGCAACAAGCAGTACGTACGCGAGTAATCAATAAGAACGAAGCT
AATGAACAGAGATAAGCATGATTAGGCGCCGCCGGTGAGCTCTTCCTCCAAGTGCGTCGCGATGACGACGTCGGAGGTGGGGTAGGCGGCGCAGGTGAGC
ACCCAGCCGGCGGCGATCTGGTCGTCGTCGAGGAAGCTCTGGTCGGACTGGTCGACGCTGCCGGCGACGACCTTGCCGGCGCAGGTGAGCACCCAGCCGG
CGGCGATCTGGTCGTCATCGAGGAAGCTCTGGTCGGACTGGTCGACGCTGCCGGCGACGACCTTGCCGGCGCAGGAGGAGCAGGACCCCGCGCGGCAGGA
GTAGGGCAGGTCGATCCCTTCCTCCTCGGCCTGGTCCAGGATGTACACGTCGTCGGGCACCTGCAGCTCCACCTCCCCGTCCGGCGTGATGAGCTTCACG
TTGTAGGTGGCCTGCGCGCGCAGCCTGGCGCCGCGGGCCGGCTTGGCCGCGGGCAGCGCCACGACGGTGGCCACCGGGGCGGCGGCGAGGCCGAGGGAGA
AGGCCGGCGCGCGGAGGCTGCTGCTCAGGGCGGTGGCCATTGGACTGTAGTGTGTGATTGCTATAGCTGCGGTAGCTGCTGCAGCAGAAGCTGGGTAGCG
ACAATGGAGTGTTTTGTTTGCTCTGCTACAGCTAGCTAGCG